Regulon of Zur in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_A5930
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	14
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.1 Sequence: ACGGCGATACGTTATATCATCGC Locus tag: Bcep18194_A5930 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Bcep18194_A5931 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Bcep18194_A5932 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Bcep18194_A5933 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Bcep18194_A5930	zur	Zinc uptake regulation protein Zur
	Bcep18194_A5931	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Bcep18194_A5932	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Bcep18194_A5933	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -8 Score: 6.1 Sequence: GAAATGATATGTTATATCGTTGC Locus tag: Bcep18194_B0316 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: Bcep18194_B0317 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: Bcep18194_B0318 Name: queD2 Funciton: 6-pyruvoyl-tetrahydropterin synthase-like Locus tag: Bcep18194_B0319 Name: can2 Funciton: Carbonic anhydrase Locus tag: Bcep18194_B0320 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3)
	Bcep18194_B0316	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Bcep18194_B0317	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	Bcep18194_B0318	queD2	6-pyruvoyl-tetrahydropterin synthase-like
	Bcep18194_B0319	can2	Carbonic anhydrase
	Bcep18194_B0320	pyrC2	Dihydroorotase (EC 3.5.2.3)
Position: -209 Score: 5.3 Sequence: GAATTGATATTTTGTATCATCTG Locus tag: Bcep18194_A4489 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Bcep18194_A4490 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein Locus tag: Bcep18194_A4491 Name: fecC Funciton: Iron-siderophore ABC transport system, substrate-binding protein Locus tag: Bcep18194_A4492 Name: fecD Funciton: Iron-siderophore ABC transport system, permease protein
	Bcep18194_A4489	omr1	Predicted zinc-related TonB-dependent outer membrane transporter
	Bcep18194_A4490	fecE	Iron-siderophore ABC transport system, ATP-binding protein
	Bcep18194_A4491	fecC	Iron-siderophore ABC transport system, substrate-binding protein
	Bcep18194_A4492	fecD	Iron-siderophore ABC transport system, permease protein
Position: -182 Score: 5.7 Sequence: GAAATGATATAACATATCATTTC Locus tag: Bcep18194_B1524 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	Bcep18194_B1524	omr	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD