Regulon of Zur in Burkholderia mallei ATCC 23344

Properties
Regulator type:	Transcription factor
TF locus tag:	BMA0329
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 9 Score: 6 Sequence: GCGCGGATACGTTATATCATCAC Locus tag: BMA0329 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: BMA0328 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: BMA0327 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BMA0326 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BMA0329	zur	Zinc uptake regulation protein Zur
	BMA0328	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	BMA0327	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BMA0326	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -301 Score: 5.8 Sequence: CGGATGATATGTTATATCATCGT Locus tag: BMA2036 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: BMA2035 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein
	BMA2036	omr1	Predicted zinc-related TonB-dependent outer membrane transporter
	BMA2035	fecE	Iron-siderophore ABC transport system, ATP-binding protein
Position: -199 Score: 4.8 Sequence: GAAATGATATAACATATCGATAC Position: -87 Score: 6.1 Sequence: ATATTGATACGTTATATCGTTTC Locus tag: BMAA0251 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	BMAA0251	omr	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD