Regulon of Zur in Burkholderia pseudomallei K96243

Properties
Regulator type:	Transcription factor
TF locus tag:	BPSL0825
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Burkholderia
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6 Sequence: GCGCGGATACGTTATATCATCAC Locus tag: BPSL0825 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: BPSL0824 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: BPSL0823 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BPSL0822 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BPSL0825	zur	Zinc uptake regulation protein Zur
	BPSL0824	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	BPSL0823	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BPSL0822	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -303 Score: 5.8 Sequence: CGGATGATATGTTATATCATCGT Locus tag: BPSL2724 Name: omr1 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: BPSL2723 Name: fecE Funciton: Iron-siderophore ABC transport system, ATP-binding protein Locus tag: BPSL2722 Name: fecC Funciton: Iron-siderophore ABC transport system, substrate-binding protein Locus tag: BPSL2721 Name: fecD Funciton: Iron-siderophore ABC transport system, permease protein
	BPSL2724	omr1	Predicted zinc-related TonB-dependent outer membrane transporter
	BPSL2723	fecE	Iron-siderophore ABC transport system, ATP-binding protein
	BPSL2722	fecC	Iron-siderophore ABC transport system, substrate-binding protein
	BPSL2721	fecD	Iron-siderophore ABC transport system, permease protein
Position: -199 Score: 4.8 Sequence: GAAATGATATAACATATCGATAC Position: -87 Score: 6.1 Sequence: ATATTGATACGTTATATCGTTTC Locus tag: BPSS1850 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	BPSS1850	omr	Predicted zinc-related TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD