Regulon of SahR in Geobacter sp. FRC-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Geob_2249
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Desulfuromonadales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.1 Sequence: ATATCAAGAAAAATTGATAT Locus tag: Geob_2249 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: Geob_2250 Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
	Geob_2249	sahR	Transcriptional regulator of methionine metabolism, ArsR family
	Geob_2250	ahcY	Adenosylhomocysteinase (EC 3.3.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD