Regulog SahR - Desulfuromonadales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfuromonadales
- By trascription factor - SahR/SamR
- By TF family - ArsR
- By effector - S-adenosylhomocysteine
- By pathway - Methionine metabolism
| Genome | Genes | Operons |
|---|---|---|
| Geobacter metallireducens GS-15 | ||
| Geobacter sulfurreducens PCA | ||
| Geobacter uraniumreducens Rf4 | 2 | 1 |
| Geobacter sp. FRC-32 | 2 | 1 |
| Geobacter sp. M21 | 2 | 1 |
| Geobacter lovleyi SZ | 2 | 1 |
| Pelobacter propionicus DSM 2379 | 3 | 1 |
| Pelobacter carbinolicus str. DSM 2380 | 2 | 1 |
| Desulfuromonas acetoxidans DSM 684 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| sahR |
|
|
*
Geobacter uraniumreducens Rf4 Site: position = -41 score = 5.54506 sequence = AAATCAAGAAAAACTGATAT Gene: Gura_3006: Transcriptional regulator of methionine metabolism, ArsR family |
*
Geobacter sp. FRC-32 Site: position = -41 score = 6.10119 sequence = ATATCAAGAAAAATTGATAT Gene: Geob_2249: Transcriptional regulator of methionine metabolism, ArsR family |
*
Geobacter sp. M21 Site: position = -45 score = 5.64132 sequence = ATATCAAGGAAACTTGATTT Gene: GM21_2939: Transcriptional regulator of methionine metabolism, ArsR family |
*
Geobacter lovleyi SZ Site: position = -43 score = 6.10119 sequence = ATATCAAGAAAAGTTGATAT Gene: Glov_0357: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pelobacter propionicus DSM 2379 Site: position = -48 score = 5.56505 sequence = ATATCAAGAATACTTGATGT Gene: Ppro_0039: Transcriptional regulator of methionine metabolism, ArsR family |
*
Pelobacter carbinolicus str. DSM 2380 Site: position = -43 score = 6.10119 sequence = ATATCAAGAAAAGTTGATAT Gene: Pcar_1925: Transcriptional regulator of methionine metabolism, ArsR family |
|
Transcriptional regulator of methionine metabolism, ArsR family |
| Ppro_0040 |
|
|
|
|
|
|
Gene: Ppro_0040: tRNA (5-methoxyuridine) 34 synthase |
|
|
tRNA (5-methoxyuridine) 34 synthase |
| ahcY |
Gene: Gmet_1294: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: GSU1875: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Gura_3005: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Geob_2250: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: GM21_2938: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Glov_0356: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Ppro_0041: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Pcar_1924: Adenosylhomocysteinase (EC 3.3.1.1) |
Gene: Dace_1960: Adenosylhomocysteinase (EC 3.3.1.1) |
Adenosylhomocysteinase (EC 3.3.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |