Regulon of SahR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll1589
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -143 Score: 6 Sequence: GGATAAAGATTTCTTTATAT Locus tag: mll5088 Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
	mll5088	ahcY	Adenosylhomocysteinase (EC 3.3.1.1)
Position: -54 Score: 6.1 Sequence: ACATAAAGACTTCTTTATAT Locus tag: mlr1220 Name: bhmT Funciton: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
	mlr1220	bhmT	Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
Position: -37 Score: 6.3 Sequence: ATATAAAGAACTCTTTATAT Locus tag: mlr1243 Name: metH2 Funciton: 5-methyltetrahydrofolate S-homocysteine methyltransferase
	mlr1243	metH2	5-methyltetrahydrofolate S-homocysteine methyltransferase
Position: -58 Score: 6.7 Sequence: ACATAAACATATGTTTATAT Locus tag: mll1589 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: mll1587 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	mll1589	sahR	Transcriptional regulator of methionine metabolism, ArsR family
	mll1587	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD