Regulon of NrtR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_06576
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -196 Score: 6.2 Sequence: TTAGTAACAAAAGTTGACAAA Locus tag: VIBHAR_06575 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	VIBHAR_06575	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Position: -215 Score: 6.2 Sequence: TTTGTCAACTTTTGTTACTAA Locus tag: VIBHAR_06576 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: VIBHAR_06577 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19)
	VIBHAR_06576	nrtR	Nudix-related transcriptional regulator NrtR
	VIBHAR_06577	pncA	Nicotinamidase (EC 3.5.1.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD