Regulog NrtR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 2 | 2 |
| Vibrio vulnificus CMCP6 | 3 | 2 |
| Vibrio harveyi ATCC BAA-1116 | 3 | 2 |
| Vibrio parahaemolyticus RIMD 2210633 | 3 | 2 |
| Vibrio shilonii AK1 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio fischeri ES114 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio angustum S14 | ||
| Photobacterium profundum SS9 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| pncB |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -103 score = 6.43655 sequence = TTTGTCACAAAAGTTGACAAA Site: position = -50 score = 5.49614 sequence = TTAGCAACAAAATGTTACTAA Gene: VCA0098: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
*
Vibrio vulnificus CMCP6 Site: position = -96 score = 6.09957 sequence = TTAGTAACAAAAATTGACAAA Gene: VV1_2372: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -196 score = 6.20385 sequence = TTAGTAACAAAAGTTGACAAA Gene: VIBHAR_06575: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -106 score = 6.20385 sequence = TTAGTAACAAAAGTTGACAAA Gene: VPA0309: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: VSAK1_23614: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
|
|
|
2
Vibrio angustum S14 Gene: VAS14_02923: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) Gene: VAS14_02928: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: PBPRA1763: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
| CRON 2. | |||||||||||
| nrtR |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -316 score = 6.43655 sequence = TTTGTCAACTTTTGTGACAAA Gene: VCA0097: Nudix-related transcriptional regulator NrtR |
*
Vibrio vulnificus CMCP6 Site: position = -203 score = 6.09957 sequence = TTTGTCAATTTTTGTTACTAA Gene: VV1_2373: Nudix-related transcriptional regulator NrtR |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -215 score = 6.20385 sequence = TTTGTCAACTTTTGTTACTAA Gene: VIBHAR_06576: Nudix-related transcriptional regulator NrtR |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -214 score = 6.20385 sequence = TTTGTCAACTTTTGTTACTAA Gene: VPA0308: Nudix-related transcriptional regulator NrtR |
|
|
|
|
|
|
Nudix-related transcriptional regulator NrtR |
| pncA |
Gene: VCA0712: Nicotinamidase (EC 3.5.1.19) |
Gene: VV1_2374: Nicotinamidase (EC 3.5.1.19) |
Gene: VIBHAR_06577: Nicotinamidase (EC 3.5.1.19) |
Gene: VPA0307: Nicotinamidase (EC 3.5.1.19) |
Gene: VSAK1_23619: Nicotinamidase (EC 3.5.1.19) |
|
|
|
Gene: VAS14_02186: Nicotinamidase (EC 3.5.1.19) |
Gene: PBPRA3449: Nicotinamidase (EC 3.5.1.19) |
Nicotinamidase (EC 3.5.1.19) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |