Regulon of NadQ in Acetobacter pasteurianus IFO 3283-01

Properties
Regulator type:	Transcription factor
TF locus tag:	APA01_20510
Regulator family:	NadQ
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:
Regulog:	NadQ - Rhodospirillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - NadQ
By TF family - NadQ
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.4 Sequence: ATATACTCAAATTGAGCATAT Locus tag: APA01_20500 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: APA01_20490 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	APA01_20500	nadA	Quinolinate synthetase (EC 4.1.99.-)
	APA01_20490	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD