Regulon of NadQ in Magnetospirillum magnetotacticum MS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Magn03004455
Regulator family:	NadQ
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:
Regulog:	NadQ - Rhodospirillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - NadQ
By TF family - NadQ
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 6 Sequence: TTATGCTCAGTCTCAGCATAT Position: -32 Score: 5.8 Sequence: CAATGCTCATTTTGAGCATAA Locus tag: Magn03003324 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Magn03003325 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	Magn03003324	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Magn03003325	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD