Regulon of NadQ in Psychrobacter sp. PRwf-1

Properties
Regulator type:	Transcription factor
TF locus tag:	PsycPRwf_1963
Regulator family:	NadQ
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:
Regulog:	NadQ - Moraxellaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - NadQ
By TF family - NadQ
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 6.7 Sequence: TTATACTCAAAATGAGCATAA Locus tag: PsycPRwf_1964 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: PsycPRwf_1965 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
	PsycPRwf_1964	nadA	Quinolinate synthetase (EC 4.1.99.-)
	PsycPRwf_1965	nadB	L-aspartate oxidase (EC 1.4.3.16)
Position: -337 Score: 6.7 Sequence: TTATGCTCATTTTGAGTATAA Locus tag: PsycPRwf_1963 Name: nadQ Funciton: Transcriptional regulator of NAD metabolism, COG4111 family
	PsycPRwf_1963	nadQ	Transcriptional regulator of NAD metabolism, COG4111 family
Position: -148 Score: 6.3 Sequence: TTATGCTCATAATGAGCATTA Locus tag: PsycPRwf_1962 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	PsycPRwf_1962	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD