Regulog NadQ - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | NadQ |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - NadQ
- By TF family - NadQ
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | ||
| Acinetobacter baumannii AB0057 | ||
| Psychrobacter arcticum 273-4 | 4 | 3 |
| Psychrobacter sp. PRwf-1 | 4 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| nadQ |
|
|
*
Psychrobacter arcticum 273-4 Site: position = -186 score = 6.75739 sequence = TTATGCTCATTTTGAGCATAA Gene: Psyc_0633: Transcriptional regulator of NAD metabolism, COG4111 family |
*
Psychrobacter sp. PRwf-1 Site: position = -337 score = 6.69484 sequence = TTATGCTCATTTTGAGTATAA Gene: PsycPRwf_1963: Transcriptional regulator of NAD metabolism, COG4111 family |
Transcriptional regulator of NAD metabolism, COG4111 family |
| CRON 2. | |||||
| nadA |
Gene: ACIAD0651: Quinolinate synthetase (EC 4.1.99.-) |
Gene: AB57_0762: Quinolinate synthetase (EC 4.1.99.-) |
*
Psychrobacter arcticum 273-4 Site: position = -107 score = 6.75739 sequence = TTATGCTCAAAATGAGCATAA Gene: Psyc_0632: Quinolinate synthetase (EC 4.1.99.-) |
*
Psychrobacter sp. PRwf-1 Site: position = -105 score = 6.69484 sequence = TTATACTCAAAATGAGCATAA Gene: PsycPRwf_1964: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
| nadB |
Gene: ACIAD2587: L-aspartate oxidase (EC 1.4.3.16) |
Gene: AB57_2967: L-aspartate oxidase (EC 1.4.3.16) |
Gene: Psyc_0631: L-aspartate oxidase (EC 1.4.3.16) |
Gene: PsycPRwf_1965: L-aspartate oxidase (EC 1.4.3.16) |
L-aspartate oxidase (EC 1.4.3.16) |
| CRON 3. | |||||
| nadC |
Gene: ACIAD0062: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: AB57_0085: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
*
Psychrobacter arcticum 273-4 Site: position = -83 score = 6.19953 sequence = TTATGCTCATTTTGAGTTTAA Gene: Psyc_0634: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
*
Psychrobacter sp. PRwf-1 Site: position = -148 score = 6.33988 sequence = TTATGCTCATAATGAGCATTA Gene: PsycPRwf_1962: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |