Regulon of NrtR in Corynebacterium diphtheriae NCTC 13129

Properties
Regulator type:	Transcription factor
TF locus tag:	DIP2256
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 4.3 Sequence: TTATCGCCCGACAGTCGAAAA Locus tag: DIP2257 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: DIP2258 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: DIP2259 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	DIP2257	nadA	Quinolinate synthetase (EC 4.1.99.-)
	DIP2258	nadB	L-aspartate oxidase (EC 1.4.3.16)
	DIP2259	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD