Regulon of DMR_45340 in Desulfovibrio magneticus RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	DMR_45340
Regulator family:	ArsR
Regulation mode:
Biological process:
Effector:
Regulog:	DMR_45340 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 6.3 Sequence: TAGTTCGTAAAAACGGAACAA Locus tag: DMR_45350 Name: null Funciton: putative hydrolase
	DMR_45350		putative hydrolase
Position: -92 Score: 6.3 Sequence: TTGTTCCGTTTTTACGAACTA Locus tag: DMR_45340 Name: null Funciton: ArsR family transcriptional regulator
	DMR_45340		ArsR family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD