Profile of regulator DMR_45340 in Desulfovibrionales
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DMR_45340 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio magneticus RS-1 | |||||
| DMR_45340 | null | -92 | 6.3 | TTGTTCCGTTTTTACGAACTA | |
| DMR_45350 | null | -86 | 6.3 | TAGTTCGTAAAAACGGAACAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |