Regulon of Dbac_0377 in Desulfomicrobium baculatum DSM 4028
| Regulator type: | Transcription factor |
| TF locus tag: | Dbac_0377 |
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | Dbac_0377 - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -45
Score: 7.7 Sequence: TTATCGTAATTCTACGATAT
Locus tag: Dbac_0377
Name: null Funciton: transcriptional regulator, ArsR family
Locus tag: Dbac_0376
Name: null Funciton: CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein
Locus tag: Dbac_0375
Name: null Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein |
|||
|
transcriptional regulator, ArsR family
|
|||
|
CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein
|
|||
|
4Fe-4S ferredoxin iron-sulfur binding domain protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |