Regulog Dbac_0377 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio magneticus RS-1 | ||
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | 3 | 1 |
| Desulfohalobium retbaense DSM 5692 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Dbac_0377 |
|
|
|
|
|
|
|
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -45 score = 7.74597 sequence = TTATCGTAATTCTACGATAT Gene: Dbac_0377: transcriptional regulator, ArsR family |
|
transcriptional regulator, ArsR family |
| Dbac_0376 |
|
|
|
|
|
|
|
|
Gene: Dbac_0376: CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein |
|
CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein |
| Dbac_0375 |
|
|
|
|
|
|
|
|
Gene: Dbac_0375: 4Fe-4S ferredoxin iron-sulfur binding domain protein |
|
4Fe-4S ferredoxin iron-sulfur binding domain protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |