Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog Dbac_0377 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 3 1
Desulfohalobium retbaense DSM 5692
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Dbac_0377
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -45
score = 7.74597
sequence = TTATCGTAATTCTACGATAT

Gene: Dbac_0377: transcriptional regulator, ArsR family
 
Desulfohalobium retbaense DSM 5692
transcriptional regulator, ArsR family
Dbac_0376
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0376: CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein
 
Desulfohalobium retbaense DSM 5692
CO dehydrogenase/acetyl-CoA synthase gamma subunit (corrinoid Fe-S protein)-like protein
Dbac_0375
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0375: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfohalobium retbaense DSM 5692
4Fe-4S ferredoxin iron-sulfur binding domain protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD