Regulon of ArsR2 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_2827
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:
Regulog:	ArsR2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.6 Sequence: GTTTTGACATCTTGACATAT Locus tag: Dbac_2827 Name: arsR2 Funciton: transcriptional regulator, ArsR family
	Dbac_2827	arsR2	transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD