Regulog ArsR2 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Arsenic resistance
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Desulfovibrio desulfuricans G20 | 4 | 1 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 4 | 1 |
| Desulfovibrio magneticus RS-1 | 1 | 1 |
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | 1 | 1 |
| Desulfohalobium retbaense DSM 5692 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Dret_1782 |
|
|
Gene: Dde_2778: redox-active disulfide protein 2 |
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -34 score = 5.41582 sequence = AATTTGCCAAATATAAACAT Site: position = -42 score = 5.66692 sequence = ATTTGGTTAATTTGCCAAAT Gene: Desal_2205: redox-active disulfide protein 2 |
Gene: DMR_37420: redox-active disulfide protein 2 |
|
|
Gene: Dret_1782: redox-active disulfide protein 2 |
redox-active disulfide protein 2 |
| trxA |
|
|
Gene: Dde_2781: Thioredoxin domain-containing protein |
|
|
Gene: Desal_2204: Thioredoxin domain-containing protein |
Gene: DMR_37430: Thioredoxin domain-containing protein |
|
|
|
Thioredoxin domain-containing protein |
| Dbac_1909 |
|
|
Gene: Dde_2782: thiol:disulfide interchange protein |
|
|
Gene: Desal_2203: thiol:disulfide interchange protein |
Gene: DMR_37440: thiol:disulfide interchange protein |
Gene: LI0122: thiol:disulfide interchange protein |
Gene: Dbac_1909: thiol:disulfide interchange protein |
|
thiol:disulfide interchange protein |
| arsR2 |
|
|
|
|
|
Gene: Desal_2202: transcriptional regulator, ArsR family |
Gene: DMR_37370: transcriptional regulator, ArsR family |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -46 score = 5.58748 sequence = GTTTTGACATCTTGACATAT Gene: Dbac_2827: transcriptional regulator, ArsR family |
|
transcriptional regulator, ArsR family |
| CRON 2. | |||||||||||
| Dde_2790 |
|
|
*
Desulfovibrio desulfuricans G20 Site: position = -143 score = 5.58748 sequence = ATTTTGATGACACTCAAAAT Gene: Dde_2790: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| arsB |
|
|
Gene: Dde_2791: Arsenical-resistance protein ACR3 |
|
|
Gene: Desal_2201: Arsenical-resistance protein ACR3 |
Gene: DMR_37380: Arsenical-resistance protein ACR3 |
|
|
|
Arsenical-resistance protein ACR3 |
| arsC-1 |
|
|
Gene: Dde_2792: Arsenate reductase (EC 1.20.4.1) |
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -226 score = 5.02156 sequence = ATTTTGGTAGTTTGAAAAAT Gene: DMR_01880: Arsenate reductase (EC 1.20.4.1) |
|
|
Gene: Dret_1452: Arsenate reductase (EC 1.20.4.1) |
Arsenate reductase (EC 1.20.4.1) |
| arsC-2 |
|
|
Gene: Dde_2793: Arsenate reductase |
|
|
|
|
|
|
|
Arsenate reductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |