Regulon of ArsR in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2281
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -12 Score: 5 Sequence: ATTTGGCGAAACATGCAAAT Locus tag: DvMF_2281 Name: arsR Funciton: ArsR family transcriptional regulator
	DvMF_2281	arsR	ArsR family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD