Regulon of ArsR in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU1645
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6 Sequence: ATTTGTCTATTTTGCCAAAT Position: -36 Score: 5 Sequence: ATTTTGCCAAATAATCAAGT Locus tag: DVU1645 Name: arsR Funciton: ArsR family transcriptional regulator Locus tag: DVU1644 Name: null Funciton: permease
	DVU1645	arsR	ArsR family transcriptional regulator
	DVU1644		permease
Position: -142 Score: 5 Sequence: ACTTGATTATTTGGCAAAAT Position: -134 Score: 6 Sequence: ATTTGGCAAAATAGACAAAT Locus tag: DVU1646 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	DVU1646	arsC	Arsenate reductase (EC 1.20.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD