Regulon of ArsR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_3295
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 4.3 Sequence: AGTTTCGTATTTGGCAAAAT Position: -31 Score: 4.9 Sequence: ATTTGGCAAAATATAAAGAC Locus tag: Desal_3294 Name: null Funciton: permease Locus tag: Desal_3293 Name: Desal_3293 Funciton: hypothetical protein
	Desal_3294		permease
	Desal_3293	Desal_3293	hypothetical protein
Position: -38 Score: 4.6 Sequence: GTTTTCCTCTTTGGCAAAAT Position: -30 Score: 5.3 Sequence: CTTTGGCAAAATATCCAAAC Locus tag: Desal_2313 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	Desal_2313	arsC	Arsenate reductase (EC 1.20.4.1)
Position: -42 Score: 5.4 Sequence: ATTTTTATATTTTGCCAAAC Position: -34 Score: 4.8 Sequence: ATTTTGCCAAACAGGAAAGT Locus tag: Desal_3295 Name: arsR Funciton: ArsR family transcriptional regulator
	Desal_3295	arsR	ArsR family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD