Regulon of ArsR in Desulfovibrio piger ATCC 29098

Properties
Regulator type:	Transcription factor
TF locus tag:	DESPIG_02964
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.6 Sequence: ATTTTGCCAAATGACCAAAT Locus tag: DESPIG_02964 Name: arsR Funciton: ArsR family transcriptional regulator
	DESPIG_02964	arsR	ArsR family transcriptional regulator
Position: -30 Score: 5.2 Sequence: ATTTGGCAATTTTGCCAATA Position: -22 Score: 4.5 Sequence: ATTTTGCCAATAAGGAATAT Locus tag: DESPIG_02962 Name: null Funciton: permease
	DESPIG_02962		permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD