Regulon of ArsR in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_3721, Dde_2776
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -88 Score: 5.7 Sequence: ATTTGGCTGAATCGCCAAAT Position: -39 Score: 5.7 Sequence: ATTTGGCGAAAAAGCCAAAT Locus tag: Dde_3721 Name: arsR Funciton: ArsR family transcriptional regulator Locus tag: Dde_3722 Name: null Funciton: permease
	Dde_3721	arsR	ArsR family transcriptional regulator
	Dde_3722		permease
Position: -31 Score: 5.5 Sequence: ATTTGGCGAATCAGCCAAAC Locus tag: Dde_2777 Name: null Funciton: permease Locus tag: Dde_2778 Name: null Funciton: redox-active disulfide protein 2
	Dde_2777		permease
	Dde_2778		redox-active disulfide protein 2
Position: -11 Score: 5.1 Sequence: GCTTGGCCTAATTGCCAAAT Locus tag: Dde_2776 Name: arsR Funciton: ArsR family transcriptional regulator
	Dde_2776	arsR	ArsR family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD