Regulon of ArsR in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_1784
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate
Regulog:	ArsR - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.2 Sequence: ATTTGGCTTTTTGGGAAAAT Position: -42 Score: 3.7 Sequence: TTTTTGGGAAAATAGAAAAT Locus tag: Dret_1783 Name: null Funciton: permease Locus tag: Dret_1782 Name: null Funciton: redox-active disulfide protein 2
	Dret_1783		permease
	Dret_1782		redox-active disulfide protein 2
Position: -20 Score: 5 Sequence: ATTTGGTTACTTTGCCAAGT Position: -12 Score: 4.2 Sequence: ACTTTGCCAAGTATGCAAAC Locus tag: Dret_1784 Name: arsR Funciton: ArsR family transcriptional regulator
	Dret_1784	arsR	ArsR family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD