Regulon of AraR in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK1907
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.7 Sequence: TTAAATATACGTACAAATTT Locus tag: GK1910 Name: araF Funciton: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2) Locus tag: GK1909 Name: araG Funciton: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2) Locus tag: GK1908 Name: araH Funciton: L-arabinose transport system permease protein (TC 3.A.1.2.2)
	GK1910	araF	L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
	GK1909	araG	L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
	GK1908	araH	L-arabinose transport system permease protein (TC 3.A.1.2.2)
Position: -75 Score: 5 Sequence: ATAATGATACGGACAAATAA Locus tag: GK1907 Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family
	GK1907	araR	Transcriptional repressor of arabinoside utilization, GntR family
Position: -61 Score: 5.6 Sequence: AAAATTGTACGTACAATAGT Locus tag: GK1906 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: GK1905 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: GK1904 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
	GK1906	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	GK1905	araB	Ribulokinase (EC 2.7.1.16)
	GK1904	araA	L-arabinose isomerase (EC 5.3.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD