Regulon of AraR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU33970
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacillales
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 5.3 Sequence: AAATGTATACGGACAAATTT Position: -109 Score: 6 Sequence: ATATTTGTACGTACTAATTA Position: -66 Score: 5.5 Sequence: ATATAAGTACGTACAATTGA Locus tag: BSU33960 Name: araE Funciton: L-arabinose-proton symporter
	BSU33960	araE	L-arabinose-proton symporter
Position: -159 Score: 5.2 Sequence: TTTTTTGTCTGTACAAATTA Locus tag: BSU28810 Name: abnA Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
	BSU28810	abnA	Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
Position: -91 Score: 5.5 Sequence: TCAATTGTACGTACTTATAT Position: -48 Score: 6 Sequence: TAATTAGTACGTACAAATAT Locus tag: BSU33970 Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family
	BSU33970	araR	Transcriptional repressor of arabinoside utilization, GntR family
Position: -103 Score: 5.9 Sequence: AAAATTGTTCGTACAAATAT Locus tag: BSU28800 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BSU28790 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: BSU28780 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BSU28770 Name: araL Funciton: L-arabinose utilization protein Locus tag: BSU28760 Name: egsA Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261) Locus tag: BSU28750 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein Locus tag: BSU28740 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: BSU28730 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: BSU28720 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BSU28800	araA	L-arabinose isomerase (EC 5.3.1.4)
	BSU28790	araB	Ribulokinase (EC 2.7.1.16)
	BSU28780	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	BSU28770	araL	L-arabinose utilization protein
	BSU28760	egsA	Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
	BSU28750	araN	Alpha-arabinosides ABC transport system, substrate-binding protein
	BSU28740	araP	Alpha-arabinosides ABC transport system, permease protein 1
	BSU28730	araQ	Alpha-arabinosides ABC transport system, permease protein 2
	BSU28720	abfA	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Position: -173 Score: 5.5 Sequence: AAATACATACGTACAAATAT Locus tag: BSU28510 Name: xsa Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
	BSU28510	xsa	Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD