Regulon of AraR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_2330
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 6.1 Sequence: ACATATGTACGTACAAATAT Locus tag: BPUM_2329 Name: araK Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: BPUM_2328 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BPUM_2327 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BPUM_2326 Name: araE Funciton: L-arabinose-proton symporter
	BPUM_2329	araK	Ribulokinase (EC 2.7.1.16)
	BPUM_2328	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	BPUM_2327	araA	L-arabinose isomerase (EC 5.3.1.4)
	BPUM_2326	araE	L-arabinose-proton symporter
Position: -191 Score: 6.1 Sequence: ATATTTGTACGTACATATGT Locus tag: BPUM_2330 Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family
	BPUM_2330	araR	Transcriptional repressor of arabinoside utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD