Regulon of AraR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_031330
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacillales
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 5.4 Sequence: TTATTTGTGCGTACTAATTT Position: -109 Score: 5.6 Sequence: TCATAAGTACGTACAAATGT Locus tag: RBAM_031320 Name: araE Funciton: L-arabinose-proton symporter
	RBAM_031320	araE	L-arabinose-proton symporter
Position: -105 Score: 5.2 Sequence: TTTTTTGTCTGTACAAATAT Locus tag: RBAM_025870 Name: abnA Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
	RBAM_025870	abnA	Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
Position: -167 Score: 5.6 Sequence: ACATTTGTACGTACTTATGA Position: -124 Score: 5.4 Sequence: AAATTAGTACGCACAAATAA Locus tag: RBAM_031330 Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family
	RBAM_031330	araR	Transcriptional repressor of arabinoside utilization, GntR family
Position: -99 Score: 5.8 Sequence: AAAATTGTTCGTACAAATAA Position: -57 Score: 5.3 Sequence: ATATTCGTACGTATATTTTT Locus tag: RBAM_025860 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: RBAM_025850 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: RBAM_025840 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: RBAM_025830 Name: araL Funciton: L-arabinose utilization protein Locus tag: RBAM_025820 Name: egsA Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261) Locus tag: RBAM_025810 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein Locus tag: RBAM_025800 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: RBAM_025790 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: RBAM_025780 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	RBAM_025860	araA	L-arabinose isomerase (EC 5.3.1.4)
	RBAM_025850	araB	Ribulokinase (EC 2.7.1.16)
	RBAM_025840	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	RBAM_025830	araL	L-arabinose utilization protein
	RBAM_025820	egsA	Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
	RBAM_025810	araN	Alpha-arabinosides ABC transport system, substrate-binding protein
	RBAM_025800	araP	Alpha-arabinosides ABC transport system, permease protein 1
	RBAM_025790	araQ	Alpha-arabinosides ABC transport system, permease protein 2
	RBAM_025780	abfA	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Position: -169 Score: 5.6 Sequence: TAATTGGTTCGTACAAATTA Locus tag: RBAM_025570 Name: xsa Funciton: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
	RBAM_025570	xsa	Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD