Regulon of NagR in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB0612
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - NagR
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.4 Sequence: TAACATGTATAGACAACTGT Locus tag: OB0611 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	OB0611	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD