Regulon of PhhR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO1823
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	PhhR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Pseudomonadaceae
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 5.5 Sequence: TCGTAACGAAAACTTTACGA Position: -88 Score: 4.9 Sequence: GTGTAACGTATTGTTGACGG Locus tag: PSPTO1823 Name: phhR Funciton: Phenylalanine degradation transcriptional activator, TyrR family
	PSPTO1823	phhR	Phenylalanine degradation transcriptional activator, TyrR family
Position: -206 Score: 4.9 Sequence: CCGTCAACAATACGTTACAC Position: -133 Score: 5.5 Sequence: TCGTAAAGTTTTCGTTACGA Locus tag: PSPTO1822 Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1) Locus tag: PSPTO1821 Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
	PSPTO1822	phhA	Phenylalanine-4-hydroxylase (EC 1.14.16.1)
	PSPTO1821	phhB	Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD