Regulon of NsrR in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK1738
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -155 Score: 7.3 Sequence: AAAACATGTATTTTTAATACATCTTTT Position: -107 Score: 6 Sequence: AAAAACAATATTTCAAATACATCTTTA Locus tag: GK1738 Name: nsrR Funciton: Transcription regulator of nitrosative stress response, Rrf2 family
	GK1738	nsrR	Transcription regulator of nitrosative stress response, Rrf2 family
Position: -91 Score: 6 Sequence: TAAAGATGTATTTGAAATATTGTTTTT Position: -43 Score: 7.3 Sequence: AAAAGATGTATTAAAAATACATGTTTT Locus tag: GK1737 Name: hmp Funciton: Flavohemoprotein
	GK1737	hmp	Flavohemoprotein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD