Regulon of NsrR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_0893
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 7.5 Sequence: AAAAGGTGTATTTTAAATACATCTTTA Position: -119 Score: 6.4 Sequence: AAAAGCAATATTTATAATACATGTTTT Locus tag: BPUM_0893 Name: nsrR Funciton: Transcription regulator of nitrosative stress response, Rrf2 family
	BPUM_0893	nsrR	Transcription regulator of nitrosative stress response, Rrf2 family
Position: -91 Score: 6.4 Sequence: AAAACATGTATTATAAATATTGCTTTT Position: -43 Score: 7.5 Sequence: TAAAGATGTATTTAAAATACACCTTTT Locus tag: BPUM_0894 Name: hmp Funciton: Flavohemoprotein
	BPUM_0894	hmp	Flavohemoprotein
Position: -72 Score: 6.6 Sequence: AAAAGGTGTATTTTATATCTATGTTTA Locus tag: BPUM_1811 Name: nasD Funciton: Nitrite reductase [NAD(P)H] large subunit (EC 1.7.1.4) Locus tag: BPUM_1810 Name: nasE Funciton: Nitrite reductase [NAD(P)H] small subunit (EC 1.7.1.4)
	BPUM_1811	nasD	Nitrite reductase [NAD(P)H] large subunit (EC 1.7.1.4)
	BPUM_1810	nasE	Nitrite reductase [NAD(P)H] small subunit (EC 1.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD