Regulon of NsrR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1057
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Bacillales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 6.2 Sequence: TAAATATGTATTTTAAATATTGATTAA Position: -48 Score: 6.7 Sequence: TAAATATGTATACAAAATACTTATTTA Locus tag: BH1058 Name: hmp Funciton: Flavohemoprotein
	BH1058	hmp	Flavohemoprotein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD