Regulon of RbsR in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_3263
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.6 Sequence: TTGTGTAAACGGTTACACAT Locus tag: BPUM_3263 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: BPUM_3264 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: BPUM_3265 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: BPUM_3266 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: BPUM_3267 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: BPUM_3268 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	BPUM_3263	rbsR	Transcriptional repressor of ribose utilization, LacI family
	BPUM_3264	rbsK	Ribokinase (EC 2.7.1.15)
	BPUM_3265	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	BPUM_3266	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	BPUM_3267	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	BPUM_3268	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD