Regulog RbsR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 6 | 1 |
| Bacillus amyloliquefaciens FZB42 | 6 | 1 |
| Bacillus pumilus SAFR-032 | 6 | 1 |
| Bacillus licheniformis DSM 13 | 6 | 1 |
| Anoxybacillus flavithermus WK1 | 6 | 1 |
| Geobacillus kaustophilus HTA426 | 6 | 1 |
| Bacillus cereus ATCC 14579 | 5 | 1 |
| Bacillus halodurans C-125 | 6 | 1 |
| Bacillus clausii KSM-K16 | 6 | 1 |
| Oceanobacillus iheyensis HTE831 | 6 | 1 |
| Paenibacillus sp. JDR-2 | 6 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| rbsR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -36 score = 6.34233 sequence = CTATGTAAACGGTTACATAA Gene: BSU35910: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -35 score = 6.34233 sequence = TTATGTAAACGGTTACATAG Gene: RBAM_033080: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus pumilus SAFR-032 Site: position = -40 score = 6.55767 sequence = TTGTGTAAACGGTTACACAT Gene: BPUM_3263: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus licheniformis DSM 13 Site: position = 17 score = 6.51405 sequence = TTATGTAAACGGTTACACAA Gene: BLi03840: Transcriptional repressor of ribose utilization, LacI family |
*
Anoxybacillus flavithermus WK1 Site: position = -36 score = 6.65469 sequence = ATATGTAACCGGTTACAGAA Gene: Aflv_2673: Transcriptional repressor of ribose utilization, LacI family |
*
Geobacillus kaustophilus HTA426 Site: position = -43 score = 6.76675 sequence = ATGTGTAACCGGTTACACAT Gene: GK3231: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus cereus ATCC 14579 Site: position = -37 score = 6.11595 sequence = TTCTGTAAACGGTTACATGA Gene: BC0659: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus halodurans C-125 Site: position = -35 score = 6.69831 sequence = ATCTGTAACCGGTTACACAT Gene: BH3727: Transcriptional repressor of ribose utilization, LacI family |
*
Bacillus clausii KSM-K16 Site: position = -35 score = 6.38627 sequence = ATCTGTAACCGGTTACATGT Gene: ABC3549: Transcriptional repressor of ribose utilization, LacI family |
*
Oceanobacillus iheyensis HTE831 Site: position = -42 score = 5.99785 sequence = ATCTGAAACCGGTTCCATAT Gene: OB2577: Transcriptional repressor of ribose utilization, LacI family |
*
Paenibacillus sp. JDR-2 Site: position = -37 score = 6.29727 sequence = ATGTGTAAACGGTTCCACAT Gene: Pjdr2_3988: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
| rbsK |
Gene: BSU35920: Ribokinase (EC 2.7.1.15) |
Gene: RBAM_033090: Ribokinase (EC 2.7.1.15) |
Gene: BPUM_3264: Ribokinase (EC 2.7.1.15) |
Gene: BLi03841: Ribokinase (EC 2.7.1.15) |
Gene: Aflv_2672: Ribokinase (EC 2.7.1.15) |
Gene: GK3230: Ribokinase (EC 2.7.1.15) |
Gene: BC0660: Ribokinase (EC 2.7.1.15) |
Gene: BH3728: Ribokinase (EC 2.7.1.15) |
3
Bacillus clausii KSM-K16 Gene: ABC3643: Ribokinase (EC 2.7.1.15) Gene: ABC3548: Ribokinase (EC 2.7.1.15) Gene: ABC3603: Ribokinase (EC 2.7.1.15) |
Gene: OB2576: Ribokinase (EC 2.7.1.15) |
Gene: Pjdr2_3987: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsD |
Gene: BSU35930: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: RBAM_033100: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: BPUM_3265: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: BLi03842: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: Aflv_2671: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: GK3229: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: BC0661: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: BH3729: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: ABC3547: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: OB2575: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: Pjdr2_3986: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: BSU35940: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: RBAM_033110: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: BPUM_3266: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: BLi03843: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: Aflv_2670: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: GK3228: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: BC0662: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: BH3730: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: ABC3546: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: OB2574: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: Pjdr2_3985: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: BSU35950: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: RBAM_033120: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: BPUM_3267: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: BLi03844: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: Aflv_2669: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: GK3227: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: BC0663: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: BH3731: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: ABC3545: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: OB2573: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: Pjdr2_3984: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
Gene: BSU35960: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: RBAM_033130: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: BPUM_3268: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: BLi03845: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Aflv_2668: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: GK3226: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: BH3732: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: ABC3544: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: OB2572: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Pjdr2_3983: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |