Regulon of GntR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3873
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 61 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 5.6 Sequence: ATTTGTTACCGGTATCATGA Position: -77 Score: 5.5 Sequence: TCATGATACCGGTAACATGG Locus tag: y3876 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	y3876	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
Position: -159 Score: 6 Sequence: CCATGTTACCGGTATCATGA Position: -145 Score: 5.1 Sequence: TCATGATACCGGTAACAAAT Locus tag: y3875 Name: gntT Funciton: High-affinity H+/gluconate symporter
	y3875	gntT	High-affinity H+/gluconate symporter
Position: -237 Score: 5.7 Sequence: TCACGTTACCGGTAACATGT Locus tag: y1651 Name: sdxX Funciton: putative 2-ketogluconate dehydrogenase
	y1651	sdxX	putative 2-ketogluconate dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD