Regulon of GntR in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_0136
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 61 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6 Sequence: GAATGTTACCCATAACAGTT Position: -58 Score: 5.4 Sequence: AACAGTTACCAGTAACATTG Locus tag: ETAE_0135 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12) Locus tag: ETAE_0134 Name: gntU Funciton: Low-affinity gluconate transporter
	ETAE_0135	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
	ETAE_0134	gntU	Low-affinity gluconate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD