Regulon of PsrA in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_0418
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Ralstonia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 4.5 Sequence: TTTCAAACGTCTGTTCCTAA Locus tag: Rpic_0418 Name: psrA Funciton: Transcriptional regulator for fatty acid degradation PsrA, TetR family Locus tag: Rpic_0417 Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) Locus tag: Rpic_0416 Name: fabG Funciton: 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)
	Rpic_0418	psrA	Transcriptional regulator for fatty acid degradation PsrA, TetR family
	Rpic_0417	fadE	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	Rpic_0416	fabG	3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD