Regulog HisR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Histidine biosynthesis |
| Effector: | Histidine |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - HisR
- By TF family - TrpR
- By effector - Histidine
- By pathway - Histidine biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 13 | 4 |
| Staphylococcus capitis SK14 | 4 | 3 |
| Staphylococcus epidermidis ATCC 12228 | 12 | 4 |
| Staphylococcus carnosus subsp. carnosus TM300 | 13 | 4 |
| Staphylococcus haemolyticus JCSC1435 | 4 | 3 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 13 | 4 |
| Macrococcus caseolyticus JCSC5402 | 3 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| hisR |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -62 score = 5.16946 sequence = CACTTTAATAGATTAATGCG Gene: SA1723: Predicted histidine repressor, TrpR family |
*
Staphylococcus capitis SK14 Site: position = -60 score = 5.07424 sequence = CACTTTAACTAATTAGTACG Gene: STACA0001_1960: Predicted histidine repressor, TrpR family |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -60 score = 5.03122 sequence = CACTTTAACGAATTAGTAAG Gene: SE1592: Predicted histidine repressor, TrpR family |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -60 score = 5.08992 sequence = CACTTTAACGTATTAGTACG Gene: Sca_1481: Predicted histidine repressor, TrpR family |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -65 score = 5.43956 sequence = CACTTTAACTATTTAATGCG Gene: SH1044: Predicted histidine repressor, TrpR family |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -61 score = 5.06836 sequence = CACTTTAATGTACTAATACG Gene: SSP0883: Predicted histidine repressor, TrpR family |
|
Predicted histidine repressor, TrpR family |
| CRON 2. | ||||||||
| yuiF |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -38 score = 5.04842 sequence = CGCTTTAGTTCGATAGAGCG Gene: SA0804: Histidine permease |
*
Staphylococcus capitis SK14 Site: position = -39 score = 4.87058 sequence = TACTTTAGTTCGATAGAGTG Gene: STACA0001_0183: Histidine permease |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -37 score = 4.87058 sequence = TACTTTAGTTCGATAGAGTG Gene: SE0637: Histidine permease |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -37 score = 4.22076 sequence = TGCTTTAGTTCGATAACGTA Gene: Sca_0548: Histidine permease |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -37 score = 4.86297 sequence = TACTTTAGTTCGGTAGAGAG Gene: SH2008: Histidine permease |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -38 score = 4.46835 sequence = TACTTTAGTTCGATAACGTG Gene: SSP1832: Histidine permease |
*
Macrococcus caseolyticus JCSC5402 Site: position = -47 score = 4.22627 sequence = TACTTTAGTATGCTAATATA Gene: MCCL_0570: Histidine permease |
Histidine permease |
| SA0805 |
Gene: SA0805: putative esterase |
Gene: STACA0001_0182: putative esterase |
Gene: SE0638: putative esterase |
Gene: Sca_0549: putative esterase |
Gene: SH2007: putative esterase |
Gene: SSP1831: putative esterase |
Gene: MCCL_0571: putative esterase |
putative esterase |
| CRON 3. | ||||||||
| SA0417 |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -27 score = 5.5165 sequence = CGCTTTAACGCTTTAAAGGA Gene: SA0417: putative sodium-dependent transporter |
*
Staphylococcus capitis SK14 Site: position = -30 score = 5.57261 sequence = CACTTTAGCGCTTTAAAGGG Gene: STACA0001_1477: putative sodium-dependent transporter |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -108 score = 5.57261 sequence = CACTTTAGCGCTTTAAAGGG Gene: SE2326: putative sodium-dependent transporter |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -143 score = 5.72011 sequence = CGCTTTAACGCTTTAAAGTA Gene: Sca_0085: putative sodium-dependent transporter |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -108 score = 5.87238 sequence = CGCTTTAACGCGTTAAAGGG Gene: SH2552: putative sodium-dependent transporter |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -47 score = 5.11013 sequence = CGCTTTAACGCAATAAAGCT Gene: SSP2298: putative sodium-dependent transporter |
*
Macrococcus caseolyticus JCSC5402 Site: position = -33 score = 5.44315 sequence = CACTTTACAGCGTTAAAACG Gene: MCCL_0041: putative sodium-dependent transporter |
putative sodium-dependent transporter |
| CRON 4. | ||||||||
| hisZ |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -84 score = 4.74132 sequence = CACTTTAGTGTGGTAGAGAA Gene: SA2472: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) |
|
*
Staphylococcus epidermidis ATCC 12228 Site: position = -56 score = 3.91433 sequence = TACTTTAATGTATTATCGAA Gene: SE0270: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -50 score = 4.86297 sequence = TACTTTAGTTCGGTAGAGAG Gene: Sca_0637: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) |
|
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -49 score = 4.63863 sequence = TACTTTAGTTCGGTAGAGAA Gene: SSP0431: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) |
|
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) |
| hisG |
Gene: SA2471: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17) |
|
Gene: SE0271: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17) |
Gene: Sca_0636: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17) |
|
Gene: SSP0430: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17) |
|
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17) |
| hisD |
Gene: SA2470: Histidinol dehydrogenase (EC 1.1.1.23) |
|
Gene: SE0272: Histidinol dehydrogenase (EC 1.1.1.23) |
Gene: Sca_0635: Histidinol dehydrogenase (EC 1.1.1.23) |
|
Gene: SSP0429: Histidinol dehydrogenase (EC 1.1.1.23) |
|
Histidinol dehydrogenase (EC 1.1.1.23) |
| hisC |
Gene: SA2469: Histidinol-phosphate aminotransferase (EC 2.6.1.9) |
|
|
Gene: Sca_0634: Histidinol-phosphate aminotransferase (EC 2.6.1.9) |
|
Gene: SSP0428: Histidinol-phosphate aminotransferase (EC 2.6.1.9) |
|
Histidinol-phosphate aminotransferase (EC 2.6.1.9) |
| hisB |
Gene: SA2468: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) |
|
Gene: SE0273: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) |
Gene: Sca_0633: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) |
|
Gene: SSP0427: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) |
|
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) |
| hisH |
Gene: SA2467: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-) |
|
Gene: SE0274: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-) |
Gene: Sca_0632: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-) |
|
Gene: SSP0426: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-) |
|
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-) |
| hisA |
Gene: SA2466: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16) |
|
Gene: SE0275: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16) |
Gene: Sca_0631: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16) |
|
Gene: SSP0425: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16) |
|
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16) |
| hisF |
Gene: SA2465: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-) |
|
Gene: SE0276: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-) |
Gene: Sca_0630: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-) |
|
Gene: SSP0424: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-) |
|
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-) |
| hisIE |
Gene: SA2464: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) |
|
Gene: SE0277: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) |
Gene: Sca_0629: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) |
|
Gene: SSP0423: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) |
|
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |