Regulon of HisR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1044
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Regulog:	HisR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HisR
By TF family - TrpR
By effector - Histidine
By pathway - Histidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 4.9 Sequence: TACTTTAGTTCGGTAGAGAG Locus tag: SH2008 Name: yuiF Funciton: Histidine permease Locus tag: SH2007 Name: SA0805 Funciton: putative esterase
	SH2008	yuiF	Histidine permease
	SH2007	SA0805	putative esterase
Position: -108 Score: 5.9 Sequence: CGCTTTAACGCGTTAAAGGG Locus tag: SH2552 Name: SA0417 Funciton: putative sodium-dependent transporter
	SH2552	SA0417	putative sodium-dependent transporter
Position: -65 Score: 5.4 Sequence: CACTTTAACTATTTAATGCG Locus tag: SH1044 Name: hisR Funciton: Predicted histidine repressor, TrpR family
	SH1044	hisR	Predicted histidine repressor, TrpR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD