Regulon of HisR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Regulog:	HisR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HisR
By TF family - TrpR
By effector - Histidine
By pathway - Histidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 4.2 Sequence: TACTTTAGTATGCTAATATA Locus tag: MCCL_0570 Name: yuiF Funciton: Histidine permease Locus tag: MCCL_0571 Name: SA0805 Funciton: putative esterase
	MCCL_0570	yuiF	Histidine permease
	MCCL_0571	SA0805	putative esterase
Position: -33 Score: 5.4 Sequence: CACTTTACAGCGTTAAAACG Locus tag: MCCL_0041 Name: SA0417 Funciton: putative sodium-dependent transporter
	MCCL_0041	SA0417	putative sodium-dependent transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD