Regulog BglR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | 5 | 2 |
| Bifidobacterium angulatum DSM 20098 | 5 | 2 |
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 4 | 1 |
| Bifidobacterium dentium Bd1 | 5 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| bglR |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -25 score = 5.83961 sequence = GCATCAAAGCGCTTAGACTG Gene: BAD_1291: Transcriptional regulator of beta-glucosides utilization, LacI family |
*
Bifidobacterium angulatum DSM 20098 Site: position = -25 score = 5.84158 sequence = GTATCAAAGCGGTTAGACTG Gene: BIFANG_00262: Transcriptional regulator of beta-glucosides utilization, LacI family |
|
|
Gene: BIFBRE_00246: Transcriptional regulator of beta-glucosides utilization, LacI family |
*
Bifidobacterium dentium Bd1 Site: position = -220 score = 5.32424 sequence = GTACCAAAGCGCTTAAATTG Gene: BDP_0953: Transcriptional regulator of beta-glucosides utilization, LacI family |
|
|
|
|
Transcriptional regulator of beta-glucosides utilization, LacI family |
| CRON 2. | |||||||||||
| bglE |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -68 score = 5.90826 sequence = AAATCTAAGCGCTTAAATTG Site: position = -42 score = 6.73726 sequence = CAATCTAAGCGGTTAGATTG Gene: BAD_1290: Beta-glucosides ABC transporter, substrate-binding protein |
*
Bifidobacterium angulatum DSM 20098 Site: position = -71 score = 5.0924 sequence = CAATCTATGCGCTTAAATAT Site: position = -45 score = 6.56763 sequence = CAGTCTAACCGCTTAGATTG Gene: BIFANG_00261: Beta-glucosides ABC transporter, substrate-binding protein |
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -52 score = 6.44678 sequence = CAATCTACGCGGTTAGATTG Gene: BIFBRE_00248: Beta-glucosides ABC transporter, substrate-binding protein |
*
Bifidobacterium dentium Bd1 Site: position = -72 score = 5.62973 sequence = CAATCTAAGCGCTTAAATAT Site: position = -46 score = 6.56763 sequence = CAGTCTAACCGCTTAGATTG Gene: BDP_0952: Beta-glucosides ABC transporter, substrate-binding protein |
|
|
|
|
Beta-glucosides ABC transporter, substrate-binding protein |
| bglF |
Gene: BAD_1289: Beta-glucosides ABC transporter, permease component 1 |
Gene: BIFANG_00260: Beta-glucosides ABC transporter, permease component 1 |
|
|
Gene: BIFBRE_00249: Beta-glucosides ABC transporter, permease component 1 |
Gene: BDP_0951: Beta-glucosides ABC transporter, permease component 1 |
|
|
|
|
Beta-glucosides ABC transporter, permease component 1 |
| bglG |
Gene: BAD_1288: Beta-glucosides ABC transporter, permease component 2 |
Gene: BIFANG_00259: Beta-glucosides ABC transporter, permease component 2 |
|
|
Gene: BIFBRE_00250: Beta-glucosides ABC transporter, permease component 2 |
Gene: BDP_0950: Beta-glucosides ABC transporter, permease component 2 |
|
|
|
|
Beta-glucosides ABC transporter, permease component 2 |
| bglB |
Gene: BAD_1287: Beta-glucosidase (EC 3.2.1.21) |
Gene: BIFANG_00258: Beta-glucosidase (EC 3.2.1.21) |
|
|
Gene: BIFBRE_00251: Beta-glucosidase (EC 3.2.1.21) |
Gene: BDP_0949: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |