Regulon of BglR in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1291
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.9 Sequence: AAATCTAAGCGCTTAAATTG Position: -42 Score: 6.7 Sequence: CAATCTAAGCGGTTAGATTG Locus tag: BAD_1290 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BAD_1289 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BAD_1288 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BAD_1287 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
	BAD_1290	bglE	Beta-glucosides ABC transporter, substrate-binding protein
	BAD_1289	bglF	Beta-glucosides ABC transporter, permease component 1
	BAD_1288	bglG	Beta-glucosides ABC transporter, permease component 2
	BAD_1287	bglB	Beta-glucosidase (EC 3.2.1.21)
Position: -25 Score: 5.8 Sequence: GCATCAAAGCGCTTAGACTG Locus tag: BAD_1291 Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family
	BAD_1291	bglR	Transcriptional regulator of beta-glucosides utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD