Regulon of BglR in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_00246
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.4 Sequence: CAATCTACGCGGTTAGATTG Locus tag: BIFBRE_00248 Name: bglE Funciton: Beta-glucosides ABC transporter, substrate-binding protein Locus tag: BIFBRE_00249 Name: bglF Funciton: Beta-glucosides ABC transporter, permease component 1 Locus tag: BIFBRE_00250 Name: bglG Funciton: Beta-glucosides ABC transporter, permease component 2 Locus tag: BIFBRE_00251 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
	BIFBRE_00248	bglE	Beta-glucosides ABC transporter, substrate-binding protein
	BIFBRE_00249	bglF	Beta-glucosides ABC transporter, permease component 1
	BIFBRE_00250	bglG	Beta-glucosides ABC transporter, permease component 2
	BIFBRE_00251	bglB	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD