Regulog IcaR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Intercellular adhesion |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - TetR
- By pathway - Intercellular adhesion
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 5 | 2 |
| Staphylococcus capitis SK14 | 5 | 2 |
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | ||
| Staphylococcus haemolyticus JCSC1435 | ||
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| icaR |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -156 score = 7.23972 sequence = ACCTACCTTTCGTTAGTTAGGT Gene: SA2458: icaADBC operon transcriptional regulator |
*
Staphylococcus capitis SK14 Site: position = -159 score = 7.23972 sequence = ACCTACCTTTCGTTAGTTAGGT Gene: STACA0001_0089: icaADBC operon transcriptional regulator |
|
Gene: Sca_0084: icaADBC operon transcriptional regulator |
|
Gene: SSP0115: icaADBC operon transcriptional regulator |
|
icaADBC operon transcriptional regulator |
| CRON 2. | ||||||||
| icaA |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -29 score = 7.23972 sequence = ACCTAACTAACGAAAGGTAGGT Gene: SA2459: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-) |
*
Staphylococcus capitis SK14 Site: position = -29 score = 7.23972 sequence = ACCTAACTAACGAAAGGTAGGT Gene: STACA0001_0088: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-) |
|
|
|
|
|
polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-) |
| icaD |
Gene: SA2460: polysaccharide intercellular adhesin biosynthesis protein |
Gene: STACA0001_0087: polysaccharide intercellular adhesin biosynthesis protein |
|
|
|
|
|
polysaccharide intercellular adhesin biosynthesis protein |
| icaB |
Gene: SA2461: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-) |
Gene: STACA0001_0086: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-) |
|
|
|
|
|
polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-) |
| icaC |
Gene: SA2462: polysaccharide intercellular adhesin biosynthesis protein |
Gene: STACA0001_0085: polysaccharide intercellular adhesin biosynthesis protein |
|
|
|
|
|
polysaccharide intercellular adhesin biosynthesis protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |