Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing icaB gene

Properties
Regulog: IcaR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Intercellular adhesion
Effector:
Phylum: Firmicutes
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -29
Score: 7.23972
Sequence: ACCTAACTAACGAAAGGTAGGT
Locus tag: SA2459
Name: icaA
Funciton: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
Locus tag: SA2460
Name: icaD
Funciton: polysaccharide intercellular adhesin biosynthesis protein
Locus tag: SA2461
Name: icaB
Funciton: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
Locus tag: SA2462
Name: icaC
Funciton: polysaccharide intercellular adhesin biosynthesis protein
icaA-icaD-icaB-icaC -29 7.2 ACCTAACTAACGAAAGGTAGGT SA2459
Staphylococcus capitis SK14
Position: -29
Score: 7.23972
Sequence: ACCTAACTAACGAAAGGTAGGT
Locus tag: STACA0001_0088
Name: icaA
Funciton: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
Locus tag: STACA0001_0087
Name: icaD
Funciton: polysaccharide intercellular adhesin biosynthesis protein
Locus tag: STACA0001_0086
Name: icaB
Funciton: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
Locus tag: STACA0001_0085
Name: icaC
Funciton: polysaccharide intercellular adhesin biosynthesis protein
icaA-icaD-icaB-icaC -29 7.2 ACCTAACTAACGAAAGGTAGGT STACA0001_0088