Regulon of IcaR in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_0089
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Intercellular adhesion
Effector:
Regulog:	IcaR - Staphylococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - TetR
By pathway - Intercellular adhesion

Regulated operons
	Locus Tag	Name	Function
Position: -159 Score: 7.2 Sequence: ACCTACCTTTCGTTAGTTAGGT Locus tag: STACA0001_0089 Name: icaR Funciton: icaADBC operon transcriptional regulator
	STACA0001_0089	icaR	icaADBC operon transcriptional regulator
Position: -29 Score: 7.2 Sequence: ACCTAACTAACGAAAGGTAGGT Locus tag: STACA0001_0088 Name: icaA Funciton: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-) Locus tag: STACA0001_0087 Name: icaD Funciton: polysaccharide intercellular adhesin biosynthesis protein Locus tag: STACA0001_0086 Name: icaB Funciton: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-) Locus tag: STACA0001_0085 Name: icaC Funciton: polysaccharide intercellular adhesin biosynthesis protein
	STACA0001_0088	icaA	polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
	STACA0001_0087	icaD	polysaccharide intercellular adhesin biosynthesis protein
	STACA0001_0086	icaB	polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
	STACA0001_0085	icaC	polysaccharide intercellular adhesin biosynthesis protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD