Regulog RbsR2 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Ribonucleoside utilization |
| Effector: | Ribose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribonucleoside utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 3 | 1 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 4 | 1 |
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | 4 | 1 |
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BL1769 |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -67 score = 6.12487 sequence = TTGGTAAAAGGTTATATCAT Site: position = -35 score = 6.49088 sequence = TTGATTAAACGTTTTATCAA Gene: BIFBRE_00473: Acyl-CoA N-acyltransferase |
|
|
*
Bifidobacterium longum NCC2705 Site: position = -109 score = 6.12487 sequence = TTGGTAAAAGGTTATATCAT Site: position = -77 score = 6.49088 sequence = TTGATTAAACGTTTTATCAA Gene: BL1769: Acyl-CoA N-acyltransferase |
|
Acyl-CoA N-acyltransferase |
| rihC |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -71 score = 6.22729 sequence = ATGATGAAACGTTAAATCAT Site: position = -102 score = 5.91868 sequence = GTGATTTAACGTCTTATCAT Gene: Blon_0638: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) |
|
|
|
|
Gene: BIFBRE_00474: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) |
|
|
Gene: BL1770: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) |
|
Non-specific ribonucleoside hydrolase (EC 3.2.-.-) |
| rihP |
|
|
|
|
|
Gene: BIFBRE_00475: Predicted ribonucleoside transporter, DcuC family |
|
|
Gene: BL1771: Predicted ribonucleoside transporter, DcuC family |
|
Predicted ribonucleoside transporter, DcuC family |
| rbsK |
Gene: Blon_0640: Ribokinase (EC 2.7.1.15) |
|
|
|
|
Gene: BIFBRE_00476: Ribokinase (EC 2.7.1.15) |
|
|
Gene: BL1772: Ribokinase (EC 2.7.1.15) |
|
Ribokinase (EC 2.7.1.15) |
| rihT |
Gene: Blon_0639: Predicted ribonucleoside transporter, MFS family |
|
|
|
|
|
|
|
|
|
Predicted ribonucleoside transporter, MFS family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |