Regulon of RbsR2 in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_0637
Regulator family:	LacI
Regulation mode:
Biological process:	Ribonucleoside utilization
Effector:	Ribose
Regulog:	RbsR2 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribonucleoside utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.9 Sequence: GTGATTTAACGTCTTATCAT Position: -71 Score: 6.2 Sequence: ATGATGAAACGTTAAATCAT Locus tag: Blon_0638 Name: rihC Funciton: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) Locus tag: Blon_0639 Name: rihT Funciton: Predicted ribonucleoside transporter, MFS family Locus tag: Blon_0640 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	Blon_0638	rihC	Non-specific ribonucleoside hydrolase (EC 3.2.-.-)
	Blon_0639	rihT	Predicted ribonucleoside transporter, MFS family
	Blon_0640	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD